Быстрый заказ

Человек NOSTRIN Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human NOSTRIN Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC014189
Размер кДНК:1287bp
Описание кДНК:Full length Clone DNA of Homo sapiens nitric oxide synthase trafficker.
Синоним гена:DaIP2, MGC20702, NOSTRIN
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек NOSTRIN Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек NOSTRIN Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14269-ACGRBS15400
Человек NOSTRIN Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14269-ACRRBS15400
Человек NOSTRIN Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14269-ANGRBS15400
Человек NOSTRIN Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14269-ANRRBS15400
Человек NOSTRIN Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14269-CFRBS13340
Человек NOSTRIN Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14269-CHRBS13340
Человек NOSTRIN Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14269-CMRBS13340
Человек NOSTRIN Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14269-CYRBS13340
Человек NOSTRIN Джин клон кДНК в вектор клонированияHG14269-GRBS5130
Человек NOSTRIN Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14269-NFRBS13340
Человек NOSTRIN Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14269-NHRBS13340
Человек NOSTRIN Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14269-NMRBS13340
Человек NOSTRIN Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14269-NYRBS13340
Человек NOSTRIN Джин ORF экспрессии кДНК клона плазмидыHG14269-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG14269-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».