After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек NOB1/NOB1P Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human NOB1 Информация о продукте «Клон cDNA»
Размер кДНК:1239bp
Описание кДНК:Full length Clone DNA of Homo sapiens NIN1/RPN12 binding protein 1 homolog (S. cerevisiae) with N terminal HA tag.
Синоним гена:ART-4; NOB1P; MST158; MSTP158; PSMD8BP1
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек NOB1/NOB1P Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Человек NOB1/NOB1P Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG16424-ACGRBS15400
Человек NOB1/NOB1P Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG16424-ACRRBS15400
Человек NOB1/NOB1P Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG16424-ANGRBS15400
Человек NOB1/NOB1P Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG16424-ANRRBS15400
Человек NOB1/NOB1P Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG16424-CFRBS13340
Человек NOB1/NOB1P Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG16424-CHRBS13340
Человек NOB1/NOB1P Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG16424-CMRBS13340
Человек NOB1/NOB1P Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG16424-CYRBS13340
Human NOB1 Gene cDNA clone plasmidHG16424-GRBS3620
Человек NOB1/NOB1P Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG16424-NFRBS13340
Человек NOB1/NOB1P Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG16424-NHRBS13340
Человек NOB1/NOB1P Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG16424-NMRBS13340
Человек NOB1/NOB1P Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG16424-NYRBS13340
Человек NOB1/NOB1P Джин клон кДНК в вектор клонированияHG16424-URBS5130
Человек NOB1/NOB1P Джин ORF экспрессии кДНК клона плазмидыHG16424-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG16424-NY
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.