Быстрый заказ

Text Size:AAA

Человек NMNAT1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human NMNAT1 Информация о продукте «Клон cDNA»
Размер кДНК:840bp
Описание кДНК:Full length Clone DNA of Homo sapiens nicotinamide nucleotide adenylyltransferase 1 with N terminal Myc tag.
Синоним гена:NMNAT, PNAT1, NMNAT1
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек NMNAT1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Человек NMNAT1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11448-ACGRBS15400
Человек NMNAT1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11448-ACRRBS15400
Человек NMNAT1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG11448-ANGRBS15400
Человек NMNAT1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG11448-ANRRBS15400
Человек NMNAT1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11448-CFRBS13340
Человек NMNAT1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11448-CHRBS13340
Человек NMNAT1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11448-CMRBS13340
Человек NMNAT1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11448-CYRBS13340
Человек NMNAT1 Gene cDNA clone plasmidHG11448-MRBS5130
Человек NMNAT1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11448-NFRBS13340
Человек NMNAT1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11448-NHRBS13340
Человек NMNAT1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11448-NMRBS13340
Человек NMNAT1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11448-NYRBS13340
Человек NMNAT1 Джин ORF экспрессии кДНК клона плазмидыHG11448-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

NMNAT, also known as NMNAT1, is a member of the Nicotinamide-nucleotide adenylyltransferases. It is widely expressed with high levels in skeletal muscle, heart, liver and kidney. NMNAT appears to have the ability to protect against axonal degeneration following mechanical or toxic insults. The coenzyme NAD and its derivatives are involved in hundreds of metabolic redox reactions and are utilized in protein ADP-ribosylation, histone deacetylation, and in some Ca(2+) signaling pathways. NMNAT enzyme is vital for NAD biosynthesis, catalyzing the condensation of nicotinamide mononucleotide (NMN) or nicotinic acid mononucleotide (NaMN) with the AMP moiety of ATP to form NAD or NaAD.

  • Sugano S. et al., 1994, Gene. 138 (1-2): 171-4.
  • Saccucci F. et al., 2001, J Biol Chem. 276 (1): 406-12.
  • Hennig K. et al., 2001, FEBS Lett. 492 (1-2): 95-100.
  • Size / Price
    Каталог: HG11448-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.