Быстрый заказ

Text Size:AAA

Человек Neuroligin 3 / NLGN3 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human NLGN3 Информация о продукте «Клон cDNA»
Размер кДНК:2487bp
Описание кДНК:Full length Clone DNA of Homo sapiens neuroligin 3 with C terminal HA tag.
Синоним гена:HNL3, ASPGX1, AUTSX1, KIAA1480, NLGN3
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек Neuroligin 3 / NLGN3 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Человек Neuroligin 3 / NLGN3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11160-ACGRBS16760
Человек Neuroligin 3 / NLGN3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11160-ACRRBS16760
Человек Neuroligin 3 / NLGN3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11160-CFRBS14710
Человек Neuroligin 3 / NLGN3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11160-CHRBS14710
Человек Neuroligin 3 / NLGN3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11160-CMRBS14710
Человек Neuroligin 3 / NLGN3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11160-CYRBS14710
Человек Neuroligin 3 / NLGN3 Джин клон кДНК в вектор клонированияHG11160-MRBS5130
Человек Neuroligin 3 / NLGN3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11160-M-FRBS14710
Человек Neuroligin 3 / NLGN3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11160-NFRBS14710
Человек Neuroligin 3 / NLGN3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11160-NHRBS14710
Человек Neuroligin 3 / NLGN3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11160-NMRBS14710
Человек Neuroligin 3 / NLGN3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11160-NYRBS14710
Человек Neuroligin 3 / NLGN3 Джин ORF экспрессии кДНК клона плазмидыHG11160-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Neuroligin 3 (NLGN3) is a member of the type-B carboxylesterase/lipase family. Neuroligins (NLGNs) are a family of presumptive postsynaptic cell adhesion molecules. Neuroligins (NLs) constitute a family of cell-surface proteins that interact with neurexins (beta-Nxs), another class of neuronal cell-surface proteins, one of each class functioning together in synapse formation. Neuroligins control the formation and functional balance of excitatory and inhibitory synapses in hippocampal neurons. NLGN1 and NLGN2 isoforms are concentrated at glutamatergic and GABAergic synapses, respectively, but the cellular expression and synaptic localization of the endogenous. NLGN3 was enriched in brain, where NLGN3 protein levels increased during postnatal development, coinciding with the peak of synaptogenesis. The NLGN3 is a synaptic adhesion molecule that is a shared component of glutamatergic and GABAergic synapses. Mutations in NLGN3 gene may be associated with autism and Asperger syndrome.

  • Chih B, et al. (2005) Control of excitatory and inhibitory synapse formation by neuroligins. Science. 307(5713): 1324-8.
  • Paraoanu LE, et al. (2006) Expression patterns of neurexin-1 and neuroligins in brain and retina of the chick embryo: Neuroligin-3 is absent in retina. Neurosci Lett. 395(2): 114-7.
  • Budreck EC, et al. (2007) Neuroligin-3 is a neuronal adhesion protein at GABAergic and glutamatergic synapses. Eur J Neurosci. 26(7): 1738-48.
  • Size / Price
    Каталог: HG11160-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.