Быстрый заказ

Text Size:AAA

Человек NKD2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human NKD2 Информация о продукте «Клон cDNA»
Размер кДНК:936bp
Описание кДНК:Full length Clone DNA of Homo sapiens naked cuticle homolog 2 (Drosophila) with C terminal Flag tag.
Синоним гена:Naked2
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек NKD2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Человек NKD2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14441-ACGRBS15396
Человек NKD2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14441-ACRRBS15396
Человек NKD2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14441-ANGRBS15396
Человек NKD2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14441-ANRRBS15396
Человек NKD2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14441-CFRBS13343
Человек NKD2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14441-CHRBS13343
Человек NKD2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14441-CMRBS13343
Человек NKD2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14441-CYRBS13343
Человек NKD2 Джин клон кДНК в вектор клонированияHG14441-GRBS5132
Человек NKD2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14441-NFRBS13343
Человек NKD2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14441-NHRBS13343
Человек NKD2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14441-NMRBS13343
Человек NKD2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14441-NYRBS13343
Человек NKD2 Джин ORF экспрессии кДНК клона плазмидыHG14441-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG14441-CF
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.