After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек NIFK Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human NIFK Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_032390.4
Размер кДНК:882bp
Описание кДНК:Full length Clone DNA of Homo sapiens nucleolar protein interacting with the FHA domain of MKI67 with C terminal His tag.
Синоним гена:Nopp34, MKI67IP
Виды:Human
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек NIFK Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек NIFK Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG16340-ACGRBS15400
Человек NIFK Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG16340-ACRRBS15400
Человек NIFK Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG16340-ANGRBS15400
Человек NIFK Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG16340-ANRRBS15400
Человек NIFK Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG16340-CFRBS13340
Человек NIFK Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG16340-CHRBS13340
Человек NIFK Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG16340-CMRBS13340
Человек NIFK Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG16340-CYRBS13340
Человек NIFK Джин клон кДНК в вектор клонированияHG16340-GRBS5130
Человек NIFK Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG16340-NFRBS13340
Человек NIFK Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG16340-NHRBS13340
Человек NIFK Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG16340-NMRBS13340
Человек NIFK Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG16340-NYRBS13340
Человек NIFK Джин ORF экспрессии кДНК клона плазмидыHG16340-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG16340-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».