After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек NFE2L1/Nrf1 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human NFE2L1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC010623
Размер кДНК:2229bp
Описание кДНК:Full length Clone DNA of Homo sapiens nuclear factor (erythroid-derived 2)-like 1.
Синоним гена:FLJ00380, LCR-F1, NRF1, TCF11, NFE2L1
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек NFE2L1/Nrf1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек NFE2L1/Nrf1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14221-ACGRBS16760
Человек NFE2L1/Nrf1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14221-ACRRBS16760
Человек NFE2L1/Nrf1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14221-ANGRBS16760
Человек NFE2L1/Nrf1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14221-ANRRBS16760
Человек NFE2L1/Nrf1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14221-CFRBS14710
Человек NFE2L1/Nrf1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14221-CHRBS14710
Человек NFE2L1/Nrf1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14221-CMRBS14710
Человек NFE2L1/Nrf1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14221-CYRBS14710
Человек NFE2L1/Nrf1 Джин клон кДНК в вектор клонированияHG14221-GRBS5130
Человек NFE2L1/Nrf1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14221-NFRBS14710
Человек NFE2L1/Nrf1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14221-NHRBS14710
Человек NFE2L1/Nrf1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14221-NMRBS14710
Человек NFE2L1/Nrf1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14221-NYRBS14710
Человек NFE2L1/Nrf1 Джин ORF экспрессии кДНК клона плазмидыHG14221-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG14221-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».