Быстрый заказ

Человек NET1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек NET1 Информация о продукте «Клон cDNA»
    Размер кДНК:1629bp
    Описание кДНК:Full length Clone DNA of Homo sapiens neuroepithelial cell transforming 1 with N terminal His tag.
    Синоним гена:NET1A, ARHGEF8
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    ( We provide with NET1 qPCR primers for gene expression analysis, HP103482 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Человек NET1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
    Человек NET1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14851-ACGRBS16760
    Человек NET1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14851-ACRRBS16760
    Человек NET1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14851-ANGRBS16760
    Человек NET1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14851-ANRRBS16760
    Человек NET1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14851-CFRBS14710
    Человек NET1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14851-CHRBS14710
    Человек NET1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14851-CMRBS14710
    Человек NET1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14851-CYRBS14710
    Человек NET1 Джин клон кДНК в вектор клонированияHG14851-GRBS5130
    Человек NET1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14851-NFRBS14710
    Человек NET1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14851-NHRBS14710
    Человек NET1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14851-NMRBS14710
    Человек NET1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14851-NYRBS14710
    Человек NET1 Джин ORF экспрессии кДНК клона плазмидыHG14851-UTRBS14710
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: HG14851-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.