Быстрый заказ

Человек NEK8 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human NEK8 Информация о продукте «Клон cDNA»
Размер кДНК:2079bp
Описание кДНК:Full length Clone DNA of Homo sapiens NIMA (never in mitosis gene a)- related kinase 8 with C terminal His tag.
Синоним гена:JCK, NEK12A, MGC138445,
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек NEK8 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек NEK8 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11122-ACGRBS16760
Человек NEK8 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11122-ACRRBS16760
Человек NEK8 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG11122-ANGRBS16760
Человек NEK8 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG11122-ANRRBS16760
Человек NEK8 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11122-CFRBS14710
Человек NEK8 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11122-CHRBS14710
Человек NEK8 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11122-CMRBS14710
Человек NEK8 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11122-CYRBS14710
Человек NEK8 Джин клон кДНК в вектор клонированияHG11122-MRBS5130
Человек NEK8 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11122-M-FRBS14710
Человек NEK8 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11122-NFRBS14710
Человек NEK8 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11122-NHRBS14710
Человек NEK8 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11122-NMRBS14710
Человек NEK8 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11122-NYRBS14710
Человек NEK8 Джин ORF экспрессии кДНК клона плазмидыHG11122-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG11122-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.