After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек NEK3 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human NEK3 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_152720.1
Размер кДНК:1521bp
Описание кДНК:Full length Clone DNA of Homo sapiens NIMA (never in mitosis gene a)-related kinase 3, transcript variant 2.
Синоним гена:HSPK36, MGC29949, NEK3
Виды:Human
переносчик:pCMV3-untagged
Plasmid:pCMV3-NEK3
Участок рестрикции:KpnI + XbaI (6.1kb + 1.52kb)
Последовательность меток:
Описание последовательности:Identical with the Gene Bank Ref. ID sequence except for the point mutation 1236T/G not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human NEK3 Gene Plasmid Map
Human NEK3 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Человек NEK3 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек NEK3 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10675-ACGRBS16760
Человек NEK3 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10675-ACRRBS16760
Человек NEK3 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG10675-ANGRBS16760
Человек NEK3 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG10675-ANRRBS16760
Человек NEK3 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10675-CFRBS14710
Человек NEK3 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10675-CHRBS14710
Человек NEK3 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10675-CMRBS14710
Человек NEK3 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10675-CYRBS14710
Человек NEK3 transcript variant 2 Джин клон кДНК в вектор клонированияHG10675-MRBS5130
Человек NEK3 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10675-M-FRBS14710
Человек NEK3 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10675-NFRBS14710
Человек NEK3 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10675-NHRBS14710
Человек NEK3 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10675-NMRBS14710
Человек NEK3 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10675-NYRBS14710
Человек NEK3 transcript variant 2 Джин ORF экспрессии кДНК клона плазмидыHG10675-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

NEK3 (NIMA (never in mitosis gene a)-related expressed kinase 3), contains 1 protein kinase domain and is a member of the NimA (never in mitosis A) family of serine/threonine protein kinases. Members of the NEK family of protein kinases share high amino acid homology with NIMA (never in mitosis gene a). NEK3 differs from other NimA family members in that it is not cell cycle regulated and is found primarily in the cytoplasm. It is activated by prolactin stimulation, leading to phosphorylation of VAV2 guanine nucleotide exchange factor, paxillin, and activation of the RAC1 GTPase. NEK3 mRNA can be detected in all the proliferating cell lines with the amount not changing during the cell cycle. Prolactin stimulates interaction between NEK3 and paxillin leading to increased paxillin phosphorylation, Analysis of breast tissue microarrays show a significant up-regulation of NEK3 expression in malignant versus normal specimens. Multiple transcript variants encoding different isoforms have been found for NEK3 gene. NEK3 may play a role in mitotic regulation.

Ссылки
  • Miller SL, et al. (2007) Nek3 kinase regulates prolactin-mediated cytoskeletal reorganization and motility of breast cancer cells. Oncogene. 26(32):4668-78.
  • Hernandez M, et al. (2006) Is there any association between nek3 and cancers with frequent 13q14 deletion?. Cancer Invest. 24(7):682-8.
  • Tanaka K, et al. (1999) Cloning and characterization of the murine Nek3 protein kinase, a novel member of the NIMA family of putative cell cycle regulators. J Biol Chem. 274(19):13491-7.
  • Size / Price
    Каталог: HG10675-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
    • Human NEK3 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».