Быстрый заказ

Человек NEGR1 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек NEGR1 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_173808.2
    Размер кДНК:1065bp
    Описание кДНК:Full length Clone DNA of Homo sapiens neuronal growth regulator 1 with N terminal HA tag.
    Синоним гена:Ntra, KILON, IGLON4, DMML2433, MGC46680, NEGR1
    Виды:Human
    переносчик:pCMV3-SP-N-HA
    Plasmid:
    Участок рестрикции:
    Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with NEGR1 qPCR primers for gene expression analysis, HP101087 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Человек NEGR1 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
    Человек NEGR1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11181-ACGRBS15400
    Человек NEGR1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11181-ACRRBS15400
    Человек NEGR1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11181-CFRBS13340
    Человек NEGR1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11181-CHRBS13340
    Человек NEGR1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11181-CMRBS13340
    Человек NEGR1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11181-CYRBS13340
    Человек NEGR1 Джин клон кДНК в вектор клонированияHG11181-MRBS5130
    Человек NEGR1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11181-NFRBS13340
    Человек NEGR1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11181-NHRBS13340
    Человек NEGR1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11181-NMRBS13340
    Человек NEGR1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11181-NYRBS13340
    Человек NEGR1 Джин ORF экспрессии кДНК клона плазмидыHG11181-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    Neuronal Growth Regulator 1, NEGR1, also known as neurotractin, or KILON, which belongs to the immunoglobulin superfamily, IgLON family. This GPI-linked cell surface glycoprotein NEGR1 is composed of three Ig-like domains and belongs to the IgLON subgroup of neural IgSF members. It is expressed in two isoforms with apparent molecular masses of 50 and 37 kD, termed L-form and S-form, respectively. NEGR1/Neurotractin participates in the regulation of neurite outgrowth in the developing brain, and is expressed on neurites of primary hippocampal neurons. Neurotractin/KILON is a trans-neural growth-promoting factor for outgrowing axons following hippocampal denervation. KILON (kindred of IgLON) and opioid-binding cell adhesion molecule belong to the IgLON subgroup of immunoglobulin superfamily together with the limbic system-associated membrane protein and neurotrimin. The alteration of modulatory function of KILON/NEGR1 for the number of dendritic synapses concomitant with changes in its localization and detergent solubility during neuronal culture development. In addition to its reported role in the brain, NEGR1 is also expressed in subcutaneous adipose tissue and acts as a central 'hub' in an obesity-related transcript network.

    Ссылки
  • Marg A, et al. (1999) Neurotractin, a novel neurite outgrowth-promoting Ig-like protein that interacts with CEPU-1 and LAMP. J Cell Biol. 145(4): 865-76.
  • Miyata S, et al. (2003) Biochemical and ultrastructural analyses of IgLON cell adhesion molecules, Kilon and OBCAM in the rat brain. Neuroscience. 117(3): 645-58.
  • Schfer M, et al. (2005) Neurotractin/kilon promotes neurite outgrowth and is expressed on reactive astrocytes after entorhinal cortex lesion. Mol Cell Neurosci. 29(4): 580-90.
  • Hashimoto T, et al. (2008) IgLON cell adhesion molecule Kilon is a crucial modulator for synapse number in hippocampal neurons. Brain Res. 1224: 1-11.
  • Size / Price
    Каталог: HG11181-NY
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».