Быстрый заказ

Человек NEDD9 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек NEDD9 Информация о продукте «Клон cDNA»
    Размер кДНК:2505bp
    Описание кДНК:Full length Clone DNA of Homo sapiens neural precursor cell expressed, developmentally down-regulated 9, transcript variant 1 with N terminal HA tag.
    Синоним гена:CAS2, CASL, HEF1, CAS-L, CASS2, dJ49G10.2, dJ761I2.1, NEDD9
    Участок рестрикции:
    Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Описание последовательности:
    ( We provide with NEDD9 qPCR primers for gene expression analysis, HP101613 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Человек NEDD9 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
    Человек NEDD9 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12085-ACGRBS22240
    Человек NEDD9 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12085-ACRRBS22240
    Человек NEDD9 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12085-CFRBS20190
    Человек NEDD9 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12085-CHRBS20190
    Человек NEDD9 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12085-CMRBS20190
    Человек NEDD9 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12085-CYRBS20190
    Человек NEDD9 transcript variant 1 Джин клон кДНК в вектор клонированияHG12085-GRBS5130
    Человек NEDD9 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12085-NFRBS20190
    Человек NEDD9 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12085-NHRBS20190
    Человек NEDD9 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12085-NMRBS20190
    Человек NEDD9 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12085-NYRBS20190
    Человек NEDD9 transcript variant 1 Джин ORF экспрессии кДНК клона плазмидыHG12085-UTRBS20190
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: HG12085-NY
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.