Быстрый заказ

Text Size:AAA

Человек NEDD9 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human NEDD9 Информация о продукте «Клон cDNA»
Размер кДНК:2505bp
Описание кДНК:Full length Clone DNA of Homo sapiens neural precursor cell expressed, developmentally down-regulated 9, transcript variant 1 with N terminal HA tag.
Синоним гена:CAS2, CASL, HEF1, CAS-L, CASS2, dJ49G10.2, dJ761I2.1, NEDD9
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек NEDD9 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Человек NEDD9 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12085-ACGRBS22238
Человек NEDD9 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12085-ACRRBS22240
Человек NEDD9 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12085-CFRBS20185
Человек NEDD9 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12085-CHRBS20185
Человек NEDD9 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12085-CMRBS20185
Человек NEDD9 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12085-CYRBS20185
Человек NEDD9 transcript variant 1 Джин клон кДНК в вектор клонированияHG12085-GRBS5132
Человек NEDD9 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12085-NFRBS20185
Человек NEDD9 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12085-NHRBS20185
Человек NEDD9 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12085-NMRBS20185
Человек NEDD9 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12085-NYRBS20185
Человек NEDD9 transcript variant 1 Джин ORF экспрессии кДНК клона плазмидыHG12085-UTRBS20185
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG12085-NY
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.