Быстрый заказ

Человек NEDD4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Человек NEDD4 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_006154.2
Размер кДНК:2703bp
Описание кДНК:Full length Clone DNA of Homo sapiens neural precursor cell expressed, developmentally down-regulated 4 with N terminal Myc tag.
Синоним гена:RPF1, NEDD4-1, KIAA0093, MGC176705, NEDD4
Виды:Human
переносчик:pCMV3-SP-N-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with NEDD4 qPCR primers for gene expression analysis, HP101314 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек NEDD4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Человек NEDD4 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11437-ACGRBS22240
Человек NEDD4 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11437-ACRRBS22240
Человек NEDD4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11437-CFRBS5130
Человек NEDD4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11437-CHRBS20190
Человек NEDD4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11437-CMRBS20190
Человек NEDD4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11437-CYRBS20190
Человек NEDD4 Джин клон кДНК в вектор клонированияHG11437-GRBS5130
Человек NEDD4 Джин клон кДНК в вектор клонированияHG11437-MRBS5130
Человек NEDD4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11437-NFRBS20190
Человек NEDD4 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11437-NHRBS20190
Человек NEDD4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11437-NMRBS20190
Человек NEDD4 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11437-NYRBS20190
Человек NEDD4 Джин ORF экспрессии кДНК клона плазмидыHG11437-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG11437-NM
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Добавить в корзинуЗапрос по оптовому заказу
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».