Быстрый заказ

Человек NDUFS8 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human NDUFS8 Информация о продукте «Клон cDNA»
Размер кДНК:633bp
Описание кДНК:Full length Clone DNA of Homo sapiens NADH dehydrogenase (ubiquinone) Fe-S protein 8, 23kDa (NADH-coenzyme Q reductase) with C terminal His tag.
Синоним гена:TYKY, CI-23k, CI23KD
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек NDUFS8 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек NDUFS8 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG16338-ACGRBS15396
Человек NDUFS8 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG16338-ACRRBS15396
Человек NDUFS8 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG16338-ANGRBS15396
Человек NDUFS8 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG16338-ANRRBS15396
Человек NDUFS8 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG16338-CFRBS13343
Человек NDUFS8 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG16338-CHRBS13343
Человек NDUFS8 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG16338-CMRBS13343
Человек NDUFS8 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG16338-CYRBS13343
Человек NDUFS8 Джин клон кДНК в вектор клонированияHG16338-GRBS5132
Человек NDUFS8 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG16338-NFRBS13343
Человек NDUFS8 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG16338-NHRBS13343
Человек NDUFS8 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG16338-NMRBS13343
Человек NDUFS8 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG16338-NYRBS13343
Человек NDUFS8 Джин ORF экспрессии кДНК клона плазмидыHG16338-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG16338-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.