Быстрый заказ

Text Size:AAA

Человек NDST3 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human NDST3 Информация о продукте «Клон cDNA»
Размер кДНК:2622bp
Описание кДНК:Full length Clone DNA of Homo sapiens N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 3 with N terminal HA tag.
Синоним гена:HSST3
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек NDST3 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Человек NDST3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15790-ACGRBS22240
Человек NDST3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15790-ACRRBS22240
Человек NDST3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15790-CFRBS20190
Человек NDST3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15790-CHRBS20190
Человек NDST3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15790-CMRBS20190
Человек NDST3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15790-CYRBS20190
Человек NDST3 Джин клон кДНК в вектор клонированияHG15790-GRBS5130
Человек NDST3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15790-NFRBS20190
Человек NDST3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15790-NHRBS20190
Человек NDST3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15790-NMRBS20190
Человек NDST3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15790-NYRBS20190
Человек NDST3 Джин ORF экспрессии кДНК клона плазмидыHG15790-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG15790-NY
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.