Nicastrin cDNA ORF Clone, Human, untagged

Price:
Size:
Number:

Nicastrin cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2130 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human nicastrin.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + XbaI (6.1kb + 2.13kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Nicastrin cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Nicastrin cDNA ORF Clone, Human, untagged: Alternative Names

APH2 cDNA ORF Clone, Human; ATAG1874 cDNA ORF Clone, Human; KIAA0253 cDNA ORF Clone, Human; NCSTN cDNA ORF Clone, Human; RP11-517F10.1 cDNA ORF Clone, Human

Nicastrin Background Information

Nicastrin (NCST, or NCT), a single-pass membrane glycoprotein that harbors a large extracellular domain, is an essential component of the gamma-secretase complex. Several lines of evidence indicate that the members of these complexes could also contribute to the control of cell death. NCT controls cell death via phosphoinositide 3-kinase/Akt and p53-dependent pathways and that this function remains independent of the activity and molecular integrity of the gamma-secretase complexes. Increasing evidences have shown that Nicastrin/NCSTN plays a crucial role in gamma-cleavage of the amyloid precursor protein (APP). The glycoprotein Nicastrin is an essential component of the gamma-secretase complex, a high molecular weight complex which also contains the presenilin proteins, Aph-1 and Pen-2. The gamma-secretase complex is not only involved in APP processing but also in the processing of an increasing number of other type I integral membrane proteins. As the largest subunit of the gamma-secretase complex, Nicastrin plays a crucial role in its activation. Inhibition of NCSTN demonstrated an altered gamma-cleavage activity, suggesting its potential implication in developing Alzheimer's disease (AD). In addition, Nicastrin can function to maintain epithelial to mesenchymal transition during breast cancer progression. Anti-nicastrin polyclonal and monoclonal antibodies were able to decrease notch1 and vimentin expression and reduced the invasive capacity of breast cancer cells in vitro.
Full Name
nicastrin
References
  • He G, et al. (2007) Degradation of nicastrin involves both proteasome and lysosome. J Neurochem. 101(4): 982-92.
  • Hayashi I, et al. (2009) Single chain variable fragment against nicastrin inhibits the gamma-secretase activity. J Biol Chem. 284(41): 27838-47.
  • Ma Z, et al. (2009) Association between promoter polymorphisms of the nicastrin gene and sporadic Alzheimer's disease in North Chinese Han population. Neurosci Lett. 458(3): 136-9.
  • Pardossi-Piquard R, et al. (2009) p53-dependent control of cell death by nicastrin: lack of requirement for presenilin-dependent gamma-secretase complex. J Neurochem. 109(1): 225-37.
  • Filipovi? A, et al. (2011) Biological and clinical implications of nicastrin expression in invasive breast cancer. Breast Cancer Res Treat. 125(1): 43-53.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait