After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек Nicastrin/NCSTN Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human NCSTN Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_015331.2
Размер кДНК:2130bp
Описание кДНК:Full length Clone DNA of Homo sapiens nicastrin with N terminal HA tag.
Синоним гена:APH2, KIAA0253, RP11-517F10.1, NCSTN
Виды:Human
переносчик:pCMV3-SP-N-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек Nicastrin/NCSTN Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Человек Nicastrin/NCSTN Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11183-ACGRBS16760
Человек Nicastrin/NCSTN Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11183-ACRRBS16760
Человек Nicastrin/NCSTN Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11183-CFRBS14710
Человек Nicastrin/NCSTN Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11183-CHRBS14710
Человек Nicastrin/NCSTN Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11183-CMRBS14710
Человек Nicastrin/NCSTN Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11183-CYRBS14710
Человек Nicastrin/NCSTN Джин клон кДНК в вектор клонированияHG11183-MRBS5130
Человек Nicastrin/NCSTN Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11183-NFRBS14710
Человек Nicastrin/NCSTN Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11183-NHRBS14710
Человек Nicastrin/NCSTN Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11183-NMRBS14710
Человек Nicastrin/NCSTN Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11183-NYRBS14710
Человек Nicastrin/NCSTN Джин ORF экспрессии кДНК клона плазмидыHG11183-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Nicastrin (NCST, or NCT), a single-pass membrane glycoprotein that harbors a large extracellular domain, is an essential component of the gamma-secretase complex. Several lines of evidence indicate that the members of these complexes could also contribute to the control of cell death. NCT controls cell death via phosphoinositide 3-kinase/Akt and p53-dependent pathways and that this function remains independent of the activity and molecular integrity of the gamma-secretase complexes. Increasing evidences have shown that Nicastrin/NCSTN plays a crucial role in gamma-cleavage of the amyloid precursor protein (APP). The glycoprotein Nicastrin is an essential component of the gamma-secretase complex, a high molecular weight complex which also contains the presenilin proteins, Aph-1 and Pen-2. The gamma-secretase complex is not only involved in APP processing but also in the processing of an increasing number of other type I integral membrane proteins. As the largest subunit of the gamma-secretase complex, Nicastrin plays a crucial role in its activation. Inhibition of NCSTN demonstrated an altered gamma-cleavage activity, suggesting its potential implication in developing Alzheimer's disease (AD). In addition, Nicastrin can function to maintain epithelial to mesenchymal transition during breast cancer progression. Anti-nicastrin polyclonal and monoclonal antibodies were able to decrease notch1 and vimentin expression and reduced the invasive capacity of breast cancer cells in vitro.

Ссылки
  • He G, et al. (2007) Degradation of nicastrin involves both proteasome and lysosome. J Neurochem. 101(4): 982-92.
  • Hayashi I, et al. (2009) Single chain variable fragment against nicastrin inhibits the gamma-secretase activity. J Biol Chem. 284(41): 27838-47.
  • Ma Z, et al. (2009) Association between promoter polymorphisms of the nicastrin gene and sporadic Alzheimer's disease in North Chinese Han population. Neurosci Lett. 458(3): 136-9.
  • Pardossi-Piquard R, et al. (2009) p53-dependent control of cell death by nicastrin: lack of requirement for presenilin-dependent gamma-secretase complex. J Neurochem. 109(1): 225-37.
  • Filipovi? A, et al. (2011) Biological and clinical implications of nicastrin expression in invasive breast cancer. Breast Cancer Res Treat. 125(1): 43-53.
  • Size / Price
    Каталог: HG11183-NY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».