After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Human NCR3LG1 natural ORF mammalian expression plasmid

ПаспортОбзорыСвязанные продуктыПротоколы
Human NCR3LG1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001202439.2
Размер кДНК:1365bp
Описание кДНК:Full length Clone DNA of Homo sapiens natural killer cell cytotoxicity receptor 3 ligand 1.
Синоним гена:B7H6, B7-H6, DKFZp686O24166
Виды:Human
переносчик:pCMV3-untagged
Plasmid:pCMV3-NCR3LG1
Участок рестрикции:KpnI + XbaI (6.1kb + 1.37kb)
Последовательность меток:
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human NCR3LG1 Gene Plasmid Map
Human NCR3LG1 natural ORF mammalian expression plasmid
Product nameProduct name
Size / Price
Каталог: HG16140-UT
Цена по прейскуранту:   (Save )
Цена:      [How to order]
НаличиеIn StockИнструкции по доставке
Изображения
  • Human NCR3LG1 natural ORF mammalian expression plasmid
    Недавно просмотренные товары
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».