After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек NCAM1 / CD56 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human NCAM1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001076682.2
Размер кДНК:2286bp
Описание кДНК:Full length Clone DNA of Homo sapiens neural cell adhesion molecule 1.
Синоним гена:CD56, NCAM, MSK39, NCAM1
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек NCAM1 / CD56 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек NCAM1 / CD56 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10673-ACGRBS16760
Человек NCAM1 / CD56 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10673-ACRRBS16760
Человек NCAM1 / CD56 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10673-CFRBS14710
Человек NCAM1 / CD56 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10673-CHRBS14710
Человек NCAM1 / CD56 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10673-CMRBS14710
Человек NCAM1 / CD56 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10673-CYRBS14710
Человек NCAM1 / CD56 Джин клон кДНК в вектор клонированияHG10673-MRBS5130
Человек NCAM1 / CD56 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10673-M-FRBS14710
Человек NCAM1 / CD56 Джин ORF экспрессии кДНК клона плазмидыHG10673-M-NRBS14710
Человек NCAM1 / CD56 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10673-NFRBS14710
Человек NCAM1 / CD56 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10673-NHRBS14710
Человек NCAM1 / CD56 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10673-NMRBS14710
Человек NCAM1 / CD56 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10673-NYRBS14710
Человек NCAM1 / CD56 Джин ORF экспрессии кДНК клона плазмидыHG10673-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

NCAM1, also known as CD56, is a neural adhesion protein (NCAM) which belongs to the immunoglobulin superfamily. NCAM is involved in neural development and in plasticity in the adult brain. UCHL1 is a novel interaction partner of both NCAM isoforms that regulates their ubiquitination and intracellular trafficking. NCAM1 is a cell adhesion molecule involved in neuron-neuron adhesion, neurite fasciculation, outgrowth of neurites, etc. NCAM1 has also been shown to be involved in the expansion of T cells and dendritic cells which play an important role in immune surveillance.

Ссылки
  • Reyes AA. et al., 1991, Mol Cell Biol. 11 (3): 1654-61.
  • Suzuki M. et al., 2003, J Biol Chem. 278 (49): 49459-68.
  • Becker C G. et al., 1996, J Neurosci Res. 45 (2): 143-52.
  • Size / Price
    Каталог: HG10673-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».