Быстрый заказ

Text Size:AAA

Человек Mevalonate kinase / MVK Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human MVK Информация о продукте «Клон cDNA»
Размер кДНК:1191bp
Описание кДНК:Full length Clone DNA of Homo sapiens mevalonate kinase with C terminal Flag tag.
Синоним гена:MK, LRBP, MVLK, POROK3
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек Mevalonate kinase / MVK Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Человек Mevalonate kinase / MVK Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13923-ACGRBS15400
Человек Mevalonate kinase / MVK Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13923-ACRRBS15400
Человек Mevalonate kinase / MVK Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG13923-ANGRBS15400
Человек Mevalonate kinase / MVK Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG13923-ANRRBS15400
Человек Mevalonate kinase / MVK Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13923-CFRBS13340
Человек Mevalonate kinase / MVK Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13923-CHRBS13340
Человек Mevalonate kinase / MVK Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13923-CMRBS13340
Человек Mevalonate kinase / MVK Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13923-CYRBS13340
Человек Mevalonate kinase / MVK Джин клон кДНК в вектор клонированияHG13923-GRBS5130
Человек Mevalonate kinase / MVK Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13923-NFRBS13340
Человек Mevalonate kinase / MVK Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13923-NHRBS13340
Человек Mevalonate kinase / MVK Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13923-NMRBS13340
Человек Mevalonate kinase / MVK Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13923-NYRBS13340
Человек Mevalonate kinase / MVK Джин ORF экспрессии кДНК клона плазмидыHG13923-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Mevalonate kinase belongs to the GHMP kinase family, Mevalonate kinase subfamily. It can be found in a wide variety of organisms from bacteria to mammals. Mevalonate kinase may be a regulatory site in cholesterol biosynthetic pathway. Defects in mevalonate kinase can cause mevalonic aciduria (MEVA). It is an accumulation of mevalonic acid which causes a variety of symptoms such as psychomotor retardation, dysmorphic features, cataracts, hepatosplenomegaly, lymphadenopathy, anemia, hypotonia, myopathy, and ataxia. Defects in mevalonate kinase can also cause hyperimmunoglobulinemia D and periodic fever syndrome (HIDS). HIDS is an autosomal recessive disease characterized by recurrent episodes of unexplained high fever associated with skin rash, diarrhea, adenopathy (swollen, tender lymph nodes), athralgias and/or arthritis.

  • Fu Z, et al. (2008) Biochemical and structural basis for feedback inhibition of Mevalonate kinase and isoprenoid metabolism. Biochemistry. 47(12):3715-24.
  • Houten SM, et al. (2000) Biochemical and genetic aspects of Mevalonate kinase and its deficiency. Biochim Biophys Acta. 1529(1-3):19-32.
  • Schafer BL, et al. (1992) Molecular cloning of human Mevalonate kinase and identification of a missense mutation in the genetic disease mevalonic aciduria. J Biol Chem. 267(19): 13229-38.
  • Size / Price
    Каталог: HG13923-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.