MUSTN1 cDNA ORF Clone, Human, C-Myc tag

Price:
Size:
Number:

MUSTN1 cDNA ORF Clone, Human, C-Myc tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
249 bp
Description
Full length Clone DNA of Human musculoskeletal, embryonic nuclear protein 1 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

MUSTN1 cDNA ORF Clone, Human, C-Myc tag: Alternative Names

MUSTANG cDNA ORF Clone, Human

MUSTN1 Background Information

The Mustang, Musculoskeletal Temporally Activated Novel-1 Gene (MUSTN1) plays an important role in regulating musculoskeletal development in mammals. Musculoskeletal embryonic nuclear protein 1 (MUSTN1) gene is involved in myogenic fusion and differentiation in rats. The MUSTN1 protein localized to the nucleus in myocardium and skeletal muscle fibers.MUSTN1 was expressed the greatest in skeletal muscle where it localized to the nucleus.The greatest relative growth rates appeared at the highest expression levels of the MUSTN1 gene, it was thought to play roles in duck muscle development.
Full Name
musculoskeletal, embryonic nuclear protein 1
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait