Быстрый заказ

Человек MTMR12 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human MTMR12 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC057393
Размер кДНК:2082bp
Описание кДНК:Full length Clone DNA of Homo sapiens myotubularin related protein 12 DNA.
Синоним гена:3-PAP, PIP3AP
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек MTMR12 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек MTMR12 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15209-ACGRBS16760
Человек MTMR12 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15209-ACRRBS16760
Человек MTMR12 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG15209-ANGRBS16760
Человек MTMR12 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG15209-ANRRBS16760
Человек MTMR12 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15209-CFRBS14710
Человек MTMR12 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15209-CHRBS14710
Человек MTMR12 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15209-CMRBS14710
Человек MTMR12 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15209-CYRBS14710
Человек MTMR12 Джин клон кДНК в вектор клонированияHG15209-GRBS5130
Человек MTMR12 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15209-NFRBS14710
Человек MTMR12 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15209-NHRBS14710
Человек MTMR12 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15209-NMRBS14710
Человек MTMR12 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15209-NYRBS14710
Человек MTMR12 Джин ORF экспрессии кДНК клона плазмидыHG15209-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG15209-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».