After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек MTHFR Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human MTHFR Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_005957.4
Размер кДНК:1971bp
Описание кДНК:Full length Clone DNA of Homo sapiens methylenetetrahydrofolate reductase (NAD(P)H).
Синоним гена:MTHFR
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек MTHFR Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек MTHFR Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12017-ACGRBS16760
Человек MTHFR Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12017-ACRRBS16760
Человек MTHFR Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG12017-ANGRBS16760
Человек MTHFR Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG12017-ANRRBS16760
Человек MTHFR Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12017-CFRBS14710
Человек MTHFR Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12017-CHRBS14710
Человек MTHFR Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12017-CMRBS14710
Человек MTHFR Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12017-CYRBS14710
Человек MTHFR Джин клон кДНК в вектор клонированияHG12017-GRBS5130
Человек MTHFR Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12017-G-FRBS14710
Человек MTHFR Джин ORF экспрессии кДНК клона плазмидыHG12017-G-NRBS14710
Человек MTHFR Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12017-NFRBS14710
Человек MTHFR Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12017-NHRBS14710
Человек MTHFR Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12017-NMRBS14710
Человек MTHFR Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12017-NYRBS14710
Человек MTHFR Джин ORF экспрессии кДНК клона плазмидыHG12017-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG12017-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».