After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек MST4/MST-4 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human MST4 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_016542.3
Размер кДНК:1251bp
Описание кДНК:Full length Clone DNA of Homo sapiens serine/threonine protein kinase MST4.
Синоним гена:MST4, MASK
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек MST4/MST-4 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек MST4/MST-4 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10667-ACGRBS15400
Человек MST4/MST-4 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10667-ACRRBS15400
Человек MST4/MST-4 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG10667-ANGRBS15400
Человек MST4/MST-4 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG10667-ANRRBS15400
Человек MST4/MST-4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10667-CFRBS13340
Человек MST4/MST-4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10667-CHRBS13340
Человек MST4/MST-4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10667-CMRBS13340
Человек MST4/MST-4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10667-CYRBS13340
Человек MST4/MST-4 Джин клон кДНК в вектор клонированияHG10667-MRBS5130
Человек MST4/MST-4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10667-M-FRBS13340
Человек MST4/MST-4 Джин ORF экспрессии кДНК клона плазмидыHG10667-M-NRBS13340
Человек MST4/MST-4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10667-NFRBS13340
Человек MST4/MST-4 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10667-NHRBS13340
Человек MST4/MST-4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10667-NMRBS13340
Человек MST4/MST-4 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10667-NYRBS13340
Человек MST4/MST-4 Джин ORF экспрессии кДНК клона плазмидыHG10667-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

MST4, also known as mammalian STE20-like protein kinase 4, is a novel member of the germinal center kinase subfamily of human Ste20-like kinases and is closely related to MST3. The 416 amino acid full-length MST4 contains a C-terminal regulatory domain and an N-terminal kinase domain, both of which are required for full activation of the kinase. MST4 is highly expressed in placenta, thymus, and peripheral blood leukocytes. MST4 specifically activates ERK but not JNK or p38 MAPK in transient transfected cells or in stable cell lines, and thus is biologically active in the activation of MEK/ERK pathway mediating cell growth and transformation. Further, MST4 kinase activity is stimulated significantly by epidermal growth factor receptor (EGFR) ligands, which are known to promote growth of certain cancer cells. Accordingly, MST4 have a potential role in signal transduction pathways involved in cancer progression. Three alternatively spliced isoform of MST4 have been isolated, and isoform 3 lacks an exon encoding kinase domain and may function as a dominant-negative regulator of the MST4 kinase.

Ссылки

1. Qian, Z. et al., 2001, J Biol Chem. 276 :22439-45.

2. Lin, JL. et al., 2001, Oncogene. 20: 6559-6569.

3. Sung V, et al., 2003, Cancer research. 63: 3356-63.

4. Ma, X. et al., 2007, Molecular biology of the cell. 18:1965-78.

5. ten Klooster JP, et al., 2009, Developmental cell. 16:551-62.

All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».