Быстрый заказ

Человек IGBF/PRSP transcript variant PSP94 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human MSMB Информация о продукте «Клон cDNA»
Размер кДНК:345bp
Описание кДНК:Full length Clone DNA of Homo sapiens microseminoprotein, beta, transcript variant PSP94 with N terminal HA tag.
Синоним гена:MSP, PSP, IGBF, MSPB, PN44, PRPS, HPC13, PSP57, PSP94, PSP-94
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек IGBF/PRSP transcript variant PSP94 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Человек IGBF/PRSP transcript variant PSP94 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10519-ACGRBS15396
Человек IGBF/PRSP transcript variant PSP94 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10519-ACRRBS15396
Человек IGBF/PRSP transcript variant PSP94 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10519-CFRBS13343
Человек IGBF/PRSP transcript variant PSP94 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10519-CHRBS13343
Человек IGBF/PRSP transcript variant PSP94 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10519-CMRBS13343
Человек IGBF/PRSP transcript variant PSP94 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10519-CYRBS13343
Человек IGBF/PRSP transcript variant PSP94 Джин клон кДНК в вектор клонированияHG10519-MRBS5132
Человек IGBF/PRSP transcript variant PSP94 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10519-M-FRBS13343
Человек IGBF/PRSP transcript variant PSP94 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10519-NFRBS13343
Человек IGBF/PRSP transcript variant PSP94 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10519-NHRBS13343
Человек IGBF/PRSP transcript variant PSP94 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10519-NMRBS13343
Человек IGBF/PRSP transcript variant PSP94 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10519-NYRBS13343
Человек IGBF/PRSP transcript variant PSP94 Джин ORF экспрессии кДНК клона плазмидыHG10519-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG10519-NY
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.