Быстрый заказ

Text Size:AAA

Человек MRTO4 / MRT4 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human MRTO4 Информация о продукте «Клон cDNA»
Размер кДНК:720bp
Описание кДНК:Full length Clone DNA of Homo sapiens mRNA turnover 4 homolog (S. cerevisiae) with N terminal HA tag.
Синоним гена:MRT4, C1orf33, dJ657E11.4
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек MRTO4 / MRT4 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Человек MRTO4 / MRT4 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14639-ACGRBS15400
Человек MRTO4 / MRT4 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14639-ACRRBS15400
Человек MRTO4 / MRT4 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14639-ANGRBS15400
Человек MRTO4 / MRT4 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14639-ANRRBS15400
Человек MRTO4 / MRT4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14639-CFRBS13340
Человек MRTO4 / MRT4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14639-CHRBS13340
Человек MRTO4 / MRT4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14639-CMRBS13340
Человек MRTO4 / MRT4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14639-CYRBS13340
Человек MRTO4 / MRT4 Джин клон кДНК в вектор клонированияHG14639-GRBS5130
Человек MRTO4 / MRT4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14639-NFRBS13340
Человек MRTO4 / MRT4 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14639-NHRBS13340
Человек MRTO4 / MRT4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14639-NMRBS13340
Человек MRTO4 / MRT4 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14639-NYRBS13340
Человек MRTO4 / MRT4 Джин ORF экспрессии кДНК клона плазмидыHG14639-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

MRTO4, also known as MRT4, belongs to the ribosomal protein L10P family. MRTO4 is a ribosomal P0-like protein showing extensive sequence similarity to the ribosomal P0 protein. The precise function of MRTO4 is currently unknown. It appears to be involved in mRNA turnover and ribosome assembly. MRTO4 acts as a trans-acting factor which modulates the assembly of the pre-60S particle.

  • Zhao J. et al., 2011, J Proteomics. 75 (2): 588-602.
  • Havugimana PC. et al., 2012, Cell. 150 (5): 1068-81.
  • Wu Z. et al., 2012, PLoS One. 7 (8): e43997.
  • Michalec B. et al., 2010, Int J Biochem Cell Biol. 42 (5): 736-48.
  • Size / Price
    Каталог: HG14639-NY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.