Быстрый заказ

Человек MRPS35 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human MRPS35 Информация о продукте «Клон cDNA»
Размер кДНК:972bp
Описание кДНК:Full length Clone DNA of Homo sapiens mitochondrial ribosomal protein S35 with C terminal His tag.
Синоним гена:MDS023, MRPS28, MRP-S28, HDCMD11P
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек MRPS35 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек MRPS35 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG16343-ACGRBS15400
Человек MRPS35 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG16343-ACRRBS15400
Человек MRPS35 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG16343-ANGRBS15400
Человек MRPS35 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG16343-ANRRBS15400
Человек MRPS35 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG16343-CFRBS13340
Человек MRPS35 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG16343-CHRBS13340
Человек MRPS35 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG16343-CMRBS13340
Человек MRPS35 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG16343-CYRBS13340
Человек MRPS35 Джин клон кДНК в вектор клонированияHG16343-GRBS5130
Человек MRPS35 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG16343-NFRBS13340
Человек MRPS35 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG16343-NHRBS13340
Человек MRPS35 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG16343-NMRBS13340
Человек MRPS35 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG16343-NYRBS13340
Человек MRPS35 Джин ORF экспрессии кДНК клона плазмидыHG16343-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG16343-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.