Быстрый заказ

Человек MRPS24 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек MRPS24 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_032014.2
    Размер кДНК:504bp
    Описание кДНК:Full length Clone DNA of Homo sapiens mitochondrial ribosomal protein S24 with C terminal HA tag.
    Синоним гена:S24mt, bMRP47, HSPC335, MRP-S24, bMRP-47
    Виды:Human
    переносчик:pCMV3-C-HA
    Plasmid:
    Участок рестрикции:
    Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with MRPS24 qPCR primers for gene expression analysis, HP105127 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Человек MRPS24 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
    Человек MRPS24 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG16377-ACGRBS15400
    Человек MRPS24 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG16377-ACRRBS15400
    Человек MRPS24 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG16377-ANGRBS15400
    Человек MRPS24 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG16377-ANRRBS15400
    Человек MRPS24 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG16377-CFRBS13340
    Человек MRPS24 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG16377-CHRBS13340
    Человек MRPS24 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG16377-CMRBS13340
    Человек MRPS24 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG16377-CYRBS13340
    Человек MRPS24 Джин клон кДНК в вектор клонированияHG16377-GRBS5130
    Человек MRPS24 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG16377-NFRBS13340
    Человек MRPS24 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG16377-NHRBS13340
    Человек MRPS24 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG16377-NMRBS13340
    Человек MRPS24 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG16377-NYRBS13340
    Человек MRPS24 Джин ORF экспрессии кДНК клона плазмидыHG16377-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».