After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек MRPL45 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human MRPL45 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_032351.4
Размер кДНК:921bp
Описание кДНК:Full length Clone DNA of Homo sapiens mitochondrial ribosomal protein L45.
Синоним гена:L45mt, MRP-L45
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек MRPL45 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек MRPL45 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG16148-ACGRBS15396
Человек MRPL45 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG16148-ACRRBS15396
Человек MRPL45 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG16148-ANGRBS15396
Человек MRPL45 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG16148-ANRRBS15396
Человек MRPL45 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG16148-CFRBS13343
Человек MRPL45 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG16148-CHRBS13343
Человек MRPL45 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG16148-CMRBS13343
Человек MRPL45 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG16148-CYRBS13343
Человек MRPL45 Джин клон кДНК в вектор клонированияHG16148-GRBS5132
Человек MRPL45 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG16148-NFRBS13343
Человек MRPL45 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG16148-NHRBS13343
Человек MRPL45 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG16148-NMRBS13343
Человек MRPL45 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG16148-NYRBS13343
Человек MRPL45 Джин ORF экспрессии кДНК клона плазмидыHG16148-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG16148-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».