After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек MRI1 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human MRI1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC001703
Размер кДНК:1110bp
Описание кДНК:Full length Clone DNA of Homo sapiens methylthioribose-1-phosphate isomerase homolog (S. cerevisiae).
Синоним гена:MTNA, Ypr118w
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек MRI1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек MRI1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14226-ACGRBS15400
Человек MRI1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14226-ACRRBS15400
Человек MRI1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14226-ANGRBS15400
Человек MRI1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14226-ANRRBS15400
Человек MRI1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14226-CFRBS13340
Человек MRI1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14226-CHRBS13340
Человек MRI1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14226-CMRBS13340
Человек MRI1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14226-CYRBS13340
Человек MRI1 Джин клон кДНК в вектор клонированияHG14226-GRBS5130
Человек MRI1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14226-NFRBS13340
Человек MRI1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14226-NHRBS13340
Человек MRI1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14226-NMRBS13340
Человек MRI1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14226-NYRBS13340
Человек MRI1 Джин ORF экспрессии кДНК клона плазмидыHG14226-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG14226-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».