Быстрый заказ

Человек MPST Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Человек MPST Информация о продукте «Клон cDNA»
Размер кДНК:954bp
Описание кДНК:Full length Clone DNA of Homo sapiens mercaptopyruvate sulfurtransferase with C terminal HA tag.
Синоним гена:MST, TST2
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
( We provide with MPST qPCR primers for gene expression analysis, HP105118 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек MPST Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Человек MPST Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG16368-ACGRBS15400
Человек MPST Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG16368-ACRRBS15400
Человек MPST Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG16368-ANGRBS15400
Человек MPST Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG16368-ANRRBS15400
Человек MPST Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG16368-CFRBS13340
Человек MPST Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG16368-CHRBS13340
Человек MPST Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG16368-CMRBS13340
Человек MPST Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG16368-CYRBS13340
Человек MPST Джин клон кДНК в вектор клонированияHG16368-GRBS5130
Человек MPST Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG16368-NFRBS13340
Человек MPST Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG16368-NHRBS13340
Человек MPST Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG16368-NMRBS13340
Человек MPST Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG16368-NYRBS13340
Человек MPST Джин ORF экспрессии кДНК клона плазмидыHG16368-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG16368-CY
Цена по прейскуранту: 
Цена:      (You Save: )
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.