MORF4L1 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Price:
Size:
Number:

MORF4L1 cDNA ORF Clone, Human, C-DDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
972 bp
Description
Full length Clone DNA of Human mortality factor 4 like 1 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

MORF4L1 cDNA ORF Clone, Human, C-DDK (Flag®) tag: Alternative Names

Eaf3 cDNA ORF Clone, Human; FWP006 cDNA ORF Clone, Human; HsT17725 cDNA ORF Clone, Human; MEAF3 cDNA ORF Clone, Human; MORFRG15 cDNA ORF Clone, Human; MRG15 cDNA ORF Clone, Human; S863-6 cDNA ORF Clone, Human

MORF4L1 Background Information

Full Name
mortality factor 4 like 1
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait