After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек MOB1B / MOBKL1A Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human MOB1B Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC038112
Размер кДНК:651bp
Описание кДНК:Full length Clone DNA of Homo sapiens MOB kinase activator 1B with C terminal His tag.
Синоним гена:MATS2, MOB4A, MOBKL1A
Виды:Human
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек MOB1B / MOBKL1A Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек MOB1B / MOBKL1A Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14016-ACGRBS15400
Человек MOB1B / MOBKL1A Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14016-ACRRBS15400
Человек MOB1B / MOBKL1A Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14016-ANGRBS15400
Человек MOB1B / MOBKL1A Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14016-ANRRBS15400
Человек MOB1B / MOBKL1A Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14016-CFRBS13340
Человек MOB1B / MOBKL1A Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14016-CHRBS13340
Человек MOB1B / MOBKL1A Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14016-CMRBS13340
Человек MOB1B / MOBKL1A Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14016-CYRBS13340
Человек MOB1B / MOBKL1A Джин клон кДНК в вектор клонированияHG14016-GRBS5130
Человек MOB1B / MOBKL1A Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14016-NFRBS13340
Человек MOB1B / MOBKL1A Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14016-NHRBS13340
Человек MOB1B / MOBKL1A Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14016-NMRBS13340
Человек MOB1B / MOBKL1A Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14016-NYRBS13340
Человек MOB1B / MOBKL1A Джин ORF экспрессии кДНК клона плазмидыHG14016-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

MST1 and MST2 are the mammalian Ste20-related protein kinases most closely related to Drosophila Hippo, a major regulator of cell proliferation and survival during development. Overexpression of MST1 or MST2 in mammalian cells is proapototic. MST1 and MST2 activity increases during mitosis, especially in nocodazole-arrested mitotic cells, where these kinases exhibit both an increase in both abundance and activation. MST1 and MST2 also can be activated nonphysiologically by okadaic acid or H2O2. The MOB1B and MOBKL1B polypeptides, homologs of the Drosophila MATS polypeptide, are identified as preferred MST1/MST2 substrates in vitro and are phosphorylated in cells in an MST1/MST2-dependent manner in mitosis and in response to okadaic acid or H2O2. MST1/MST2-catalyzed MOB1B/MOBKL1B phosphorylation alters the ability of MOB1B/MOBKL1B to bind and regulate downstream targets such as the NDR-family protein kinases. Thus, MOB1B/MOBKL1B phosphorylation in cells promotes MOB1B/MOBKL1B binding to the LATS1 kinase and enables H2O2-stimulated LATS1 activation loop phosphorylation. Most importantly, replacement of endogenous MOB1B/MOBKL1B by a nonphosphorylatable mutant is sufficient to accelerate cell proliferation substantially by speeding progression through G1/S as well as mitotic exit.

Ссылки
  • Ota T, et al. (2004) Complete sequencing and characterization of 21,243 full-length human cDNAs. Nat Genet. 36(1):40-5.
  • Gerhard DS, et al. (2004) The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). Genome Res. 14(10B):2121-7.
  • Devroe E, et al. (2004) Human Mob proteins regulate the NDR1 and NDR2 serine-threonine kinases. J Biol Chem. 279(23):24444-51.
  • Praskova M, et al. (2008) MOB1B/MOBKL1B phosphorylation by MST1 and MST2 inhibits cell proliferation. Curr Biol. 18(5):311-21.
  • Size / Price
    Каталог: HG14016-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».