MMP13 cDNA ORF Clone, Human, N-HA tag

Price:
Size:
Number:

MMP13 cDNA ORF Clone, Human, N-HA tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1416 bp
Description
Full length Clone DNA of Human matrix metallopeptidase 13 (collagenase 3) with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

MMP13 cDNA ORF Clone, Human, N-HA tag: Alternative Names

CLG3 cDNA ORF Clone, Human; MANDP1 cDNA ORF Clone, Human; MMP-13 cDNA ORF Clone, Human

MMP13 Background Information

Matrix metalloproteinases (MMPs) such as MMP13 promote tumour growth and progression by mediating extracellular matrix (ECM) reorganization and regulating the biological activity of cytokines.Matrix metalloproteinase 13 (MMP13) plays a central role in the MMP activation cascade that enables degradation of the extracellular matrix and basement membranes, and it is identified as a potential driver in oral carcinogenesis.MMP13 is enriched in mature chondrocytes and considered a prime cause of ECM degradation in the osteoarthritic articular cartilage in temporomandibular joints. A missense mutation of MMP13 causes the Missouri type of human spondyloepimetaphyseal dysplasia (SEMD(MO)), an autosomal dominant disorder characterized by defective growth and modeling of vertebrae and long bones.
Full Name
matrix metallopeptidase 13
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait