Быстрый заказ

Человек MMP-14/MMP14 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human MMP14 Информация о продукте «Клон cDNA»
Размер кДНК:1749bp
Описание кДНК:Full length Clone DNA of Homo sapiens matrix metallopeptidase 14 (membrane-inserted) with N terminal His tag.
Синоним гена:MMP-X1, MTMMP1, MT1-MMP, MMP14
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек MMP-14/MMP14 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек MMP-14/MMP14 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10741-ACGRBS16760
Человек MMP-14/MMP14 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10741-ACRRBS16760
Человек MMP-14/MMP14 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10741-CFRBS14710
Человек MMP-14/MMP14 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10741-CHRBS14710
Человек MMP-14/MMP14 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10741-CMRBS14710
Человек MMP-14/MMP14 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10741-CYRBS14710
Человек MMP-14/MMP14 Джин клон кДНК в вектор клонированияHG10741-MRBS5130
Человек MMP-14/MMP14 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10741-NFRBS14710
Человек MMP-14/MMP14 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10741-NHRBS14710
Человек MMP-14/MMP14 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10741-NMRBS14710
Человек MMP-14/MMP14 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10741-NYRBS14710
Человек MMP-14/MMP14 Джин ORF экспрессии кДНК клона плазмидыHG10741-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG10741-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.