Быстрый заказ

Text Size:AAA

Человек MMGT1 / EMC5 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human MMGT1 Информация о продукте «Клон cDNA»
Размер кДНК:396bp
Описание кДНК:Full length Clone DNA of Homo sapiens membrane magnesium transporter 1 with C terminal His tag.
Синоним гена:EMC5, TMEM32, MMGT1
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек MMGT1 / EMC5 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек MMGT1 / EMC5 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13998-ACGRBS15400
Человек MMGT1 / EMC5 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13998-ACRRBS15400
Человек MMGT1 / EMC5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13998-CFRBS13340
Человек MMGT1 / EMC5 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13998-CHRBS13340
Человек MMGT1 / EMC5 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13998-CMRBS13340
Человек MMGT1 / EMC5 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13998-CYRBS13340
Человек MMGT1 / EMC5 Джин клон кДНК в вектор клонированияHG13998-GRBS5130
Человек MMGT1 / EMC5 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13998-NFRBS13340
Человек MMGT1 / EMC5 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13998-NHRBS13340
Человек MMGT1 / EMC5 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13998-NMRBS13340
Человек MMGT1 / EMC5 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13998-NYRBS13340
Человек MMGT1 / EMC5 Джин ORF экспрессии кДНК клона плазмидыHG13998-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

MMGT1, also known as EMC5, is comparable with primary microglial cells with respect to morphology, presence of acetylated low density lipoprotein receptor, non-specific esterase, CD63, major histocompatibility complex antigens and CD11, and binding for Ricinus communis agglutinin. Primary microglia as well as MMGT1 cells are negative for glial fibrillary acidic protein. Different MMGT1 strains are obtained after subcloning, two of which resembled histiocytes (F4/80 and BM-8). These cell strains, MMGT12 and 16, are able to opsonize latex beads, and could be induced by endotoxins (LPS) to secrete TNF-alpha, IL-1, IL-6, TGF-beta, and EGF.

  • Goytain A. et al., 2008, Am J Physiol Cell Physiol. 294 (2): C495-502.
  • Briers TW. et al., 1994, J Neuroimmunol. 52 (2): 153-64.
  • Jäger S. et al., 2011, Nature. 481 (7381): 365-70.
  • Size / Price
    Каталог: HG13998-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.