After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек MLH1 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human MLH1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_000249
Размер кДНК:2271bp
Описание кДНК:Full length Clone DNA of Homo sapiens mutL homolog 1, colon cancer, nonpolyposis type 2 (E. coli).
Синоним гена:HNPCC, FCC2, HNPCC2
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек MLH1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек MLH1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12041-ACGRBS16760
Человек MLH1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12041-ACRRBS16760
Человек MLH1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG12041-ANGRBS16760
Человек MLH1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG12041-ANRRBS16760
Человек MLH1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12041-CFRBS14710
Человек MLH1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12041-CHRBS14710
Человек MLH1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12041-CMRBS14710
Человек MLH1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12041-CYRBS14710
Человек MLH1 Джин клон кДНК в вектор клонированияHG12041-GRBS5130
Человек MLH1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12041-NFRBS14710
Человек MLH1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12041-NHRBS14710
Человек MLH1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12041-NMRBS14710
Человек MLH1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12041-NYRBS14710
Человек MLH1 Джин ORF экспрессии кДНК клона плазмидыHG12041-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG12041-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».