Быстрый заказ

Человек MLH1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Человек MLH1 Информация о продукте «Клон cDNA»
Размер кДНК:2271bp
Описание кДНК:Full length Clone DNA of Homo sapiens mutL homolog 1, colon cancer, nonpolyposis type 2 (E. coli) with C terminal His tag.
Участок рестрикции:KpnI+XbaI (6kb+2.32kb)
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
( We provide with MLH1 qPCR primers for gene expression analysis, HP101575 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек MLH1 Gene Plasmid Map
Human MLH1 ORF mammalian expression plasmid, C-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек MLH1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек MLH1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12041-ACGRBS16760
Человек MLH1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12041-ACRRBS16760
Человек MLH1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG12041-ANGRBS16760
Человек MLH1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG12041-ANRRBS16760
Человек MLH1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12041-CFRBS14710
Человек MLH1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12041-CHRBS14710
Человек MLH1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12041-CMRBS14710
Человек MLH1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12041-CYRBS14710
Человек MLH1 Джин клон кДНК в вектор клонированияHG12041-GRBS5130
Человек MLH1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12041-NFRBS14710
Человек MLH1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12041-NHRBS14710
Человек MLH1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12041-NMRBS14710
Человек MLH1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12041-NYRBS14710
Человек MLH1 Джин ORF экспрессии кДНК клона плазмидыHG12041-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG12041-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Contact Us
  • Human MLH1 ORF mammalian expression plasmid, C-His tag
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.