After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек MIF4GD Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human MIF4GD Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC033759
Размер кДНК:771bp
Описание кДНК:Full length Clone DNA of Homo sapiens MIF4G domain containing with C terminal HA tag.
Синоним гена:MIFD, AD023, SLIP1, MIF4GD
Виды:Human
переносчик:pCMV3-C-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек MIF4GD Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Человек MIF4GD Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14042-ACGRBS15400
Человек MIF4GD Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14042-ACRRBS15400
Человек MIF4GD Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14042-ANGRBS15400
Человек MIF4GD Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14042-ANRRBS15400
Человек MIF4GD Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14042-CFRBS13340
Человек MIF4GD Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14042-CHRBS13340
Человек MIF4GD Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14042-CMRBS13340
Человек MIF4GD Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14042-CYRBS13340
Человек MIF4GD Джин клон кДНК в вектор клонированияHG14042-GRBS5130
Человек MIF4GD Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14042-NFRBS13340
Человек MIF4GD Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14042-NHRBS13340
Человек MIF4GD Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14042-NMRBS13340
Человек MIF4GD Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14042-NYRBS13340
Человек MIF4GD Джин ORF экспрессии кДНК клона плазмидыHG14042-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG14042-CY
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».