Быстрый заказ

Text Size:AAA

Человек MID1IP1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human MID1IP1 Информация о продукте «Клон cDNA»
Размер кДНК:552bp
Описание кДНК:Full length Clone DNA of Homo sapiens MID1 interacting protein 1 with C terminal His tag.
Синоним гена:S14R, MIG12, THRSPL, G12-like, STRAIT11499, MID1IP1
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек MID1IP1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек MID1IP1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14005-ACGRBS15400
Человек MID1IP1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14005-ACRRBS15400
Человек MID1IP1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14005-ANGRBS15400
Человек MID1IP1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14005-ANRRBS15400
Человек MID1IP1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14005-CFRBS13340
Человек MID1IP1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14005-CHRBS13340
Человек MID1IP1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14005-CMRBS13340
Человек MID1IP1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14005-CYRBS13340
Человек MID1IP1 Джин клон кДНК в вектор клонированияHG14005-GRBS5130
Человек MID1IP1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14005-NFRBS13340
Человек MID1IP1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14005-NHRBS13340
Человек MID1IP1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14005-NMRBS13340
Человек MID1IP1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14005-NYRBS13340
Человек MID1IP1 Джин ORF экспрессии кДНК клона плазмидыHG14005-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

MID1IP1 belongs to the SPOT14 family. It is a homodimer in the absence of THRSP. MID1IP1 interacts with ACACA and ACACB. It plays a role in the regulation of lipogenesis in liver. It up-regulates ACACA enzyme activity. MID1IP1 is required for efficient lipid biosynthesis, including triacylglycerol, diacylglycerol and phospholipid. MID1IP1 is involved in stabilization of microtubules. Its interaction with THRSP interferes with ACACA binding.

  • Aipoalani DL. et al., 2010, Endocrinology. 151 (5): 2071-7.
  • Colbert CL. et al., 2010, Proc Natl Acad Sci. 107 (44): 18820-5.
  • Inoue J. et al., 2011, Mol Endocrinol. 25 (6): 995-1005.
  • Size / Price
    Каталог: HG14005-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.