Быстрый заказ

Человек MID1IP1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек MID1IP1 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:BC008908
    Размер кДНК:552bp
    Описание кДНК:Full length Clone DNA of Homo sapiens MID1 interacting protein 1 with C terminal His tag.
    Синоним гена:S14R, MIG12, THRSPL, G12-like, STRAIT11499, MID1IP1
    Виды:Human
    переносчик:pCMV3-C-His
    Plasmid:
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with MID1IP1 qPCR primers for gene expression analysis, HP102661 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Человек MID1IP1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
    Человек MID1IP1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14005-ACGRBS15400
    Человек MID1IP1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14005-ACRRBS15400
    Человек MID1IP1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14005-ANGRBS15400
    Человек MID1IP1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14005-ANRRBS15400
    Человек MID1IP1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14005-CFRBS13340
    Человек MID1IP1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14005-CHRBS13340
    Человек MID1IP1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14005-CMRBS13340
    Человек MID1IP1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14005-CYRBS13340
    Человек MID1IP1 Джин клон кДНК в вектор клонированияHG14005-GRBS5130
    Человек MID1IP1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14005-NFRBS13340
    Человек MID1IP1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14005-NHRBS13340
    Человек MID1IP1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14005-NMRBS13340
    Человек MID1IP1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14005-NYRBS13340
    Человек MID1IP1 Джин ORF экспрессии кДНК клона плазмидыHG14005-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    MID1IP1 belongs to the SPOT14 family. It is a homodimer in the absence of THRSP. MID1IP1 interacts with ACACA and ACACB. It plays a role in the regulation of lipogenesis in liver. It up-regulates ACACA enzyme activity. MID1IP1 is required for efficient lipid biosynthesis, including triacylglycerol, diacylglycerol and phospholipid. MID1IP1 is involved in stabilization of microtubules. Its interaction with THRSP interferes with ACACA binding.

    Ссылки
  • Aipoalani DL. et al., 2010, Endocrinology. 151 (5): 2071-7.
  • Colbert CL. et al., 2010, Proc Natl Acad Sci. 107 (44): 18820-5.
  • Inoue J. et al., 2011, Mol Endocrinol. 25 (6): 995-1005.
  • Size / Price
    Каталог: HG14005-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».