After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек MICB Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human MICB Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_005931.2
Размер кДНК:1152bp
Описание кДНК:Full length Clone DNA of Homo sapiens MHC class I polypeptide-related sequence B with N terminal His tag.
Синоним гена:PERB11.2, MICB
Виды:Human
переносчик:pCMV3-SP-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек MICB Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек MICB Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10759-ACGRBS15400
Человек MICB Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10759-ACRRBS15400
Человек MICB Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10759-CFRBS13340
Человек MICB Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10759-CHRBS13340
Человек MICB Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10759-CMRBS13340
Человек MICB Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10759-CYRBS13340
Человек MICB Джин клон кДНК в вектор клонированияHG10759-MRBS5130
Человек MICB Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10759-M-FRBS13340
Человек MICB Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10759-NFRBS13340
Человек MICB Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10759-NHRBS13340
Человек MICB Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10759-NMRBS13340
Человек MICB Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10759-NYRBS13340
Человек MICB Джин ORF экспрессии кДНК клона плазмидыHG10759-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

MHC class I polypeptide-related sequence B, also known as MICB, is a heavily glycosylated protein serving as a ligand for the type I I receptor NKG2D. MICB shares 85% amino acid identity with MICA, a closely related protein, both of which contain three extracellular immunoglobulin-like domains, but without capacity to bind peptide or interact with beta-2-microglobulin. acting as a stress-induced self-antigen, binding of MICB to the NKG2D receptor activates the cytolytic response of natural killer (NK) cells, CD8+αβ T cells, and γδ T cells on which the receptor is expressed. MICA/B are minimally expressed on normal cells, but are frequently expressed on epithelial tumors and can be induced by bacterial and viral infections. MICA/B recognition thus is involved in tumor surveillance, viral infections, and autoimmune diseases.

Ссылки
  • Bauer, S. et al., 1999, Science. 285:727-729.
  • Braud, V.M. et al., 1999, Curr. Opin. Immunol. 11: 100-108.
  • Groh, V. et al., 2001, Nature Immunol. 2: 255-260.
  • Stephens, H., 2001, Trends Immunol. 22: 378-385.
  • Borrego, F. et al., 2002, Mol. Immunol. 38: 637–660.
  • Groh, V. et al., 2002, Nature. 419:734-738.
  • Size / Price
    Каталог: HG10759-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».