After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек MICA Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human MICA Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC016929
Размер кДНК:1152bp
Описание кДНК:Full length Clone DNA of Homo sapiens MHC class I polypeptide-related sequence A with N terminal His tag.
Синоним гена:MIC-A, PERB11.1, MICA
Виды:Human
переносчик:pCMV3-SP-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек MICA Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек MICA Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12302-ACGRBS15400
Человек MICA Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12302-ACRRBS15400
Человек MICA Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12302-CFRBS13340
Человек MICA Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12302-CHRBS13340
Человек MICA Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12302-CMRBS13340
Человек MICA Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12302-CYRBS13340
Человек MICA Джин клон кДНК в вектор клонированияHG12302-GRBS5130
Человек MICA Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12302-NFRBS13340
Человек MICA Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12302-NHRBS13340
Человек MICA Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12302-NMRBS13340
Человек MICA Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12302-NYRBS13340
Человек MICA Джин ORF экспрессии кДНК клона плазмидыHG12302-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

MHC class I chain-related molecules A (MICA) is one of the genes in the HLA class I region, which belongs to MHC class I family. It is the member of the non-classical class I family that displays the greatest degree of polymorphism. The MICA protein product is expressed on the cell surface, although unlike canonical class I molecules does not seem to associate with beta-2-microglobulin. It is thought that MICA functions as a stress-induced antigen that is broadly recognized by NK cells, NKT cells, and most of the subtypes of T cells. The Natural killer group 2D (NKG2D), a C-type lectin-like activating immunoreceptor, is a receptor of MICA, which was detected on most gammadelta T cells, CD8+ alphabeta T cells, and natural killer (NK) cells. Effector cells from all these subsets could be stimulated by ligation of NKG2D. Engagement of NKG2D activated cytolytic responses of gammadelta T cells and NK cells against transfectants and epithelial tumor cells expressing MICA. The MICA system is a novel, avidin-free immunohistochemical detection system that provides a significant increase in sensitivity compared to traditional immunodetection systems.

Ссылки
  • Choy MK, et al. (2010) MICA polymorphism: biology and importance in immunity and disease. Trends Mol Med. 16(3): 97-106.
  • Li J, et al. (2005) Distinct pattern of human Vdelta1 gammadelta T cells recognizing MICA. Cell Mol Immunol. 2(4): 253-8.
  • Mangham DC, et al. (2000) MICA-a highly sensitive and avidin-free immunohistochemical detection system. Adv Anat Pathol. 7(6): 360-4.
  • Bauer S, et al. (1999) Activation of NK cells and T cells by NKG2D, a receptor for stress-inducible MICA. Science. 285(5428): 727-9.
  • Groh V, et al. (1998) Recognition of stress-induced MHC molecules by intestinal epithelial gammadelta T cells. Science. 279: 1737-40.
  • Size / Price
    Каталог: HG12302-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».