After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек MGRN1 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human MGRN1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC050389
Размер кДНК:1731bp
Описание кДНК:Full length Clone DNA of Homo sapiens mahogunin ring finger 1, E3 ubiquitin protein ligase DNA.
Синоним гена:RNF156
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек MGRN1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек MGRN1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15227-ACGRBS16760
Человек MGRN1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15227-ACRRBS16760
Человек MGRN1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG15227-ANGRBS16760
Человек MGRN1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG15227-ANRRBS16760
Человек MGRN1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15227-CFRBS14710
Человек MGRN1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15227-CHRBS14710
Человек MGRN1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15227-CMRBS14710
Человек MGRN1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15227-CYRBS14710
Человек MGRN1 Джин клон кДНК в вектор клонированияHG15227-GRBS5130
Человек MGRN1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15227-NFRBS14710
Человек MGRN1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15227-NHRBS14710
Человек MGRN1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15227-NMRBS14710
Человек MGRN1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15227-NYRBS14710
Человек MGRN1 Джин ORF экспрессии кДНК клона плазмидыHG15227-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG15227-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».