Быстрый заказ

Человек MGRN1 Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек MGRN1 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:BC050389
    Размер кДНК:1731bp
    Описание кДНК:Full length Clone DNA of Homo sapiens mahogunin ring finger 1, E3 ubiquitin protein ligase DNA.
    Синоним гена:RNF156
    Виды:Human
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with MGRN1 qPCR primers for gene expression analysis, HP103853 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Человек MGRN1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Человек MGRN1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15227-ACGRBS16760
    Человек MGRN1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15227-ACRRBS16760
    Человек MGRN1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG15227-ANGRBS16760
    Человек MGRN1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG15227-ANRRBS16760
    Человек MGRN1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15227-CFRBS14710
    Человек MGRN1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15227-CHRBS14710
    Человек MGRN1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15227-CMRBS14710
    Человек MGRN1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15227-CYRBS14710
    Человек MGRN1 Джин клон кДНК в вектор клонированияHG15227-GRBS5130
    Человек MGRN1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15227-NFRBS14710
    Человек MGRN1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15227-NHRBS14710
    Человек MGRN1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15227-NMRBS14710
    Человек MGRN1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15227-NYRBS14710
    Человек MGRN1 Джин ORF экспрессии кДНК клона плазмидыHG15227-UTRBS14710
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: HG15227-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».