After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек MGAT5 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human MGAT5 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_002410.3
Размер кДНК:2226bp
Описание кДНК:Full length Clone DNA of Homo sapiens mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase with N terminal His tag.
Синоним гена:GNT-V, GNT-VA, MGAT5
Виды:Human
переносчик:pCMV3-SP-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек MGAT5 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек MGAT5 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11373-ACGRBS16764
Человек MGAT5 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11373-ACRRBS16764
Человек MGAT5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11373-CFRBS14711
Человек MGAT5 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11373-CHRBS14711
Человек MGAT5 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11373-CMRBS14711
Человек MGAT5 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11373-CYRBS14711
Человек MGAT5 Джин клон кДНК в вектор клонированияHG11373-MRBS5132
Человек MGAT5 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11373-NFRBS14711
Человек MGAT5 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11373-NHRBS14711
Человек MGAT5 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11373-NMRBS14711
Человек MGAT5 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11373-NYRBS14711
Человек MGAT5 Джин ORF экспрессии кДНК клона плазмидыHG11373-UTRBS14711
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Alpha-1,6-mannosylglycoprotein 6-beta-N-acetylglucosaminyltransferase A, also known as Alpha-mannoside beta-1,6-N-acetylglucosaminyl-transferase, Mannoside acetylglucosaminyltransferase 5, N-acetylglucosaminyl-transferase V, MGAT5 and GGNT5, is a single-pass type I I membrane protein which belongs to the glycosyltransferase 18 family. MGAT5 / GGNT5 catalyzes the addition of N-acetylglucosamine in beta 1-6 linkage to the alpha-linked mannose of biantennary N-linked oligosaccharides. It is one of the most important enzymes involved in the regulation of the biosynthesis of glycoprotein oligosaccharides. The central nervous system (CNS) is rich in glycoconjugates, located on cell surface and in extracellular matrix. MGAT5 / GGNT5 modification of complex-type N-glycans on CNS glycoproteins is involved in the regulation of depression-like behavior. Inhibitors of MGAT5 / GGNT5 might be useful in the treatment of malignancies by targeting their dependency on focal adhesion signaling for growth and metastasis.

Ссылки
  • Morgan,R. et al., 2004,J Immunol  173 (12): 7200-8.
  • Cheung,P. et al., 2007,Glycobiology  17 (7): 767-73.
  • Li,D. et al., 2008, J Immunol 180 (5): 3158-65.
  • Soleimani,L. et al., 2008, Genes Brain Behav. 7 (3):334-43.
  • Size / Price
    Каталог: HG11373-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».