After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек MFAP4 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human MFAP4 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_002404.1
Размер кДНК:768bp
Описание кДНК:Full length Clone DNA of Homo sapiens microfibrillar-associated protein 4.
Синоним гена:MFAP4
Виды:Human
переносчик:pCMV3-untagged
Plasmid:pCMV3-MFAP4
Участок рестрикции:KpnI + XbaI (6.1kb + 0.77kb)
Последовательность меток:
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human MFAP4 Gene Plasmid Map
Human MFAP4 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Человек MFAP4 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек MFAP4 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11195-ACGRBS15400
Человек MFAP4 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11195-ACRRBS15400
Человек MFAP4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11195-CFRBS13340
Человек MFAP4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11195-CHRBS13340
Человек MFAP4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11195-CMRBS13340
Человек MFAP4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11195-CYRBS13340
Человек MFAP4 Джин клон кДНК в вектор клонированияHG11195-MRBS5130
Человек MFAP4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11195-M-FRBS13340
Человек MFAP4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11195-NFRBS13340
Человек MFAP4 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11195-NHRBS13340
Человек MFAP4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11195-NMRBS13340
Человек MFAP4 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11195-NYRBS13340
Человек MFAP4 Джин ORF экспрессии кДНК клона плазмидыHG11195-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG11195-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
НаличиеIn Stock
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
  • Human MFAP4 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Недавно просмотренные товары
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».