Быстрый заказ

Человек Meteorin / METRN Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human METRN Информация о продукте «Клон cDNA»
Размер кДНК:882bp
Описание кДНК:Full length Clone DNA of Homo sapiens meteorin, glial cell differentiation regulator with C terminal HA tag.
Синоним гена:MGC2601, C16orf23, c380A1.2, METRN
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек Meteorin / METRN Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Человек Meteorin / METRN Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13433-ACGRBS15400
Человек Meteorin / METRN Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13433-ACRRBS15400
Человек Meteorin / METRN Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13433-CFRBS13340
Человек Meteorin / METRN Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13433-CHRBS13340
Человек Meteorin / METRN Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13433-CMRBS13340
Человек Meteorin / METRN Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13433-CYRBS13340
Человек Meteorin / METRN Джин клон кДНК в вектор клонированияHG13433-GRBS5130
Человек Meteorin / METRN Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13433-NFRBS13340
Человек Meteorin / METRN Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13433-NHRBS13340
Человек Meteorin / METRN Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13433-NMRBS13340
Человек Meteorin / METRN Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13433-NYRBS13340
Человек Meteorin / METRN Джин ORF экспрессии кДНК клона плазмидыHG13433-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Meteorin is a novel secreted protein that is expressed in undifferentiated neural progenitors and in the astrocyte lineage, including radial glia. It plays important roles in the differentiation of glial cells and also in axonal network formation during neurogenesis. Meteorin selectively promoted astrocyte formation from mouse cerebrocortical neurospheres in differentiation culture, whereas it induced cerebellar astrocytes to become radial glia. Meteorin also induced axonal extension in small and intermediate neurons of sensory ganglia by activating nearby satellite glia.

  • Martin J, et al. (2004) The sequence and analysis of duplication-rich human chromosome 16. Nature. 432(7020):988-94.
  • Nishino J, et al. (2004) Meteorin: a secreted protein that regulates glial cell differentiation and promotes axonal extension. EMBO J. 23(9):1998-2008.
  • Ota T, et al. (2004) Complete sequencing and characterization of 21,243 full-length human cDNAs. Nat Genet. 36(1):40-5.
  • Size / Price
    Каталог: HG13433-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.