After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек MEK1/MAP2K1/MKK1 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human MAP2K1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_002755.3
Размер кДНК:1182bp
Описание кДНК:Full length Clone DNA of Homo sapiens mitogen-activated protein kinase kinase 1.
Синоним гена:MEK1, MKK1, MAPKK1, PRKMK1, MAP2K1
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек MEK1/MAP2K1/MKK1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек MEK1/MAP2K1/MKK1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10661-ACGRBS15400
Человек MEK1/MAP2K1/MKK1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10661-ACRRBS15400
Человек MEK1/MAP2K1/MKK1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG10661-ANGRBS15400
Человек MEK1/MAP2K1/MKK1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG10661-ANRRBS15400
Человек MEK1/MAP2K1/MKK1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10661-CFRBS13340
Человек MEK1/MAP2K1/MKK1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10661-CHRBS13340
Человек MEK1/MAP2K1/MKK1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10661-CMRBS13340
Человек MEK1/MAP2K1/MKK1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10661-CYRBS13340
Человек MEK1/MAP2K1/MKK1 Джин клон кДНК в вектор клонированияHG10661-MRBS5130
Человек MEK1/MAP2K1/MKK1 Джин ORF экспрессии кДНК клона плазмидыHG10661-M-NRBS13340
Человек MEK1/MAP2K1/MKK1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10661-NFRBS13340
Человек MEK1/MAP2K1/MKK1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10661-NHRBS13340
Человек MEK1/MAP2K1/MKK1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10661-NMRBS13340
Человек MEK1/MAP2K1/MKK1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10661-NYRBS13340
Человек MEK1/MAP2K1/MKK1 Джин ORF экспрессии кДНК клона плазмидыHG10661-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

MEK1, also known as MAP2K1 and MKK1, is a member of the dual specificity protein kinase family, which acts as a mitogen-activated protein (MAP) kinase kinase. MAP kinases, also known as extracellular signal-regulated kinases (ERKs), act as an integration point for multiple biochemical signals. MEK1 is widely expressed, with extremely low levels in brain. It lies upstream of MAP kinases and stimulates the enzymatic activity of MAP kinases upon wide variety of extra- and intracellular signals. As an essential component of MAP kinase signal transduction pathway, MEK1 is involved in many cellular processes such as proliferation, differentiation, transcription regulation and development. Binding extracellular ligands such as growth factors, cytokines and hormones to their cell-surface receptors activates RAS and this initiates RAF1 activation. RAF1 then further activates the dual-specificity protein kinases MAP2K1 and MEK2. MEK1 has been shown to export PPARG from the nucleus. The MAPK cascade is also involved in the regulation of endosomal dynamics, including lysosome processing and endosome cycling through the perinuclear recycling compartment (PNRC), as well as in the fragmentation of the Golgi apparatus during mitosis. MKK1 catalyzes the concomitant phosphorylation of a threonine and a tyrosine residue in a Thr-Glu-Tyr sequence located in MAP kinases. Defects in MEK1 can cause cardiofaciocutaneous syndrome.

Ссылки
  • Rampoldi L, et al. (1998) Chromosomal localization of four MAPK signaling cascade genes: MEK1, MEK3, MEK4 and MEKK5. Cytogenet Cell Genet. 78(3-4):301-3.
  • Zheng CF, et al. (1993) Cloning and characterization of two distinct human extracellular signal-regulated kinase activator kinases, MEK1 and MEK2. J Biol Chem. 268(15):11435-9.
  • Nantel, et al. (1998) Interaction of the Grb10 adapter protein with the Raf1 and MEK1 kinases. J Biol Chem. 273(17):10475-84.
  • Hirata H, et al. (2012) I MicroRNA-1826 targets VEGFC, beta-catenin (CTNNB1) and MEK1 (MAP2K1) in human bladder cancer. Carcinogenesis. 33(1):41-8.
  • Size / Price
    Каталог: HG10661-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».