Быстрый заказ

Человек MEF2D Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Человек MEF2D Информация о продукте «Клон cDNA»
Размер кДНК:1566bp
Описание кДНК:Full length Clone DNA of Homo sapiens myocyte enhancer factor 2D with N terminal Myc tag.
Синоним гена:MEF2D
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
( We provide with MEF2D qPCR primers for gene expression analysis, HP104103 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек MEF2D Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Человек MEF2D Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15481-ACGRBS16760
Человек MEF2D Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15481-ACRRBS16760
Человек MEF2D Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG15481-ANGRBS16760
Человек MEF2D Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG15481-ANRRBS16760
Человек MEF2D Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15481-CFRBS14710
Человек MEF2D Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15481-CHRBS14710
Человек MEF2D Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15481-CMRBS14710
Человек MEF2D Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15481-CYRBS14710
Человек MEF2D Джин клон кДНК в вектор клонированияHG15481-GRBS5130
Человек MEF2D Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15481-NFRBS14710
Человек MEF2D Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15481-NHRBS14710
Человек MEF2D Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15481-NMRBS14710
Человек MEF2D Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15481-NYRBS14710
Человек MEF2D Джин ORF экспрессии кДНК клона плазмидыHG15481-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG15481-NM
Цена по прейскуранту: 
Цена:      (You Save: )
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.