Быстрый заказ

Человек MECP2 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек MECP2 Информация о продукте «Клон cDNA»
    Размер кДНК:1461bp
    Описание кДНК:Full length Clone DNA of Homo sapiens methyl CpG binding protein 2 (Rett syndrome) with C terminal His tag.
    Синоним гена:MECP2
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    ( We provide with MECP2 qPCR primers for gene expression analysis, HP101584 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Человек MECP2 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
    Человек MECP2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12052-ACGRBS15400
    Человек MECP2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12052-ACRRBS15400
    Человек MECP2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG12052-ANGRBS15400
    Человек MECP2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG12052-ANRRBS15400
    Человек MECP2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12052-CFRBS13340
    Человек MECP2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12052-CHRBS13340
    Человек MECP2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12052-CMRBS13340
    Человек MECP2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12052-CYRBS13340
    Человек MECP2 Джин клон кДНК в вектор клонированияHG12052-GRBS5130
    Человек MECP2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12052-NFRBS13340
    Человек MECP2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12052-NHRBS13340
    Человек MECP2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12052-NMRBS13340
    Человек MECP2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12052-NYRBS13340
    Человек MECP2 Джин ORF экспрессии кДНК клона плазмидыHG12052-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: HG12052-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.