MDGA2 cDNA ORF Clone, Human, N-His tag

Price:
Size:
Number:

MDGA2 cDNA ORF Clone, Human, N-His tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2871 bp
Description
Full length Clone DNA of Human MAM domain containing glycosylphosphatidylinositol anchor 2 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

MDGA2 cDNA ORF Clone, Human, N-His tag: Alternative Names

c14_5286 cDNA ORF Clone, Human; MAMDC1 cDNA ORF Clone, Human

MDGA2 Background Information

MAM domain-containing glycosylphosphatidylinositol anchor protein 2, also known as MAM domain-containing protein 1, MDGA2 and MAMDC1, is a cell membrane protein which contains sixIg-like (immunoglobulin-like) domains and oneMAM domain. Analyses of the full-length coding region of MDGA1 and MDGA2 indicate that they encode proteins that comprise a novel subgroup of the Ig superfamily and have a unique structural organization consisting of six immunoglobulin (Ig)-like domains followed by a single MAM domain. Biochemical characterization demonstrates that MDGA1 and MDGA2 proteins are highly glycosylated, and that MDGA1 is tethered to the cell membrane by a GPI anchor. The MDGAs are differentially expressed by subpopulations of neurons in both the central and peripheral nervous systems, including neurons of the basilar pons, inferior olive, cerebellum, cerebral cortex, olfactory bulb, spinal cord, and dorsal root and trigeminal ganglia. The similarity of MDGAs to other Ig-containing molecules and their temporal-spatial patterns of expression within restricted neuronal populations, for example migrating pontine neurons and D1 spinal interneurons, suggest a role for these novel proteins in regulating neuronal migration, as well as other aspects of neural development, including axon guidance.
Full Name
MAM domain containing glycosylphosphatidylinositol anchor 2
References
  • Litwack,ED. et al., 2004, Mol Cell Neurosci. 25 (2): 263-74.
  • Hellquist, A. et al., 2009, PLoS One. 4 (12): e8037.
  • Sano,S. et al., 2009, Genesis. 47 (8):505-13.
  • Bucan, M. et al., 2009, PLoS Genet. 5 (6):e1000536.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait